counter Mtdbheader

Mangrove Transcriptome Database (v3)

Query: Rmv3_21623

Size: 112

GI: 33415263

Accession: AAQ18140

Short ID: enolase (2-phospho-d-glycerate hydroylase)

Eval: 4.36E-11

Mean Similarity: 94

Alignment Length: 111

GO Function: copper ion binding; magnesium ion binding; phosphopyruvate hydratase activity;

GO Process: response to salt stress; response to light stimulus; response to cold; response to abscisic acid stimulus; glycolysis; tryptophan biosynthetic process; gluconeogenesis; tyrosine biosynthetic process; L-phenylalanine biosynthetic process;

GO Component: phosphopyruvate hydratase complex; cell surface; mitochondrial envelope; chloroplast; nucleus; plasma membrane; apoplast;

GO Slim Function: binding; catalytic activity;

GO Slim Process: response to stress; response to abiotic stimulus; response to endogenous stimulus; generation of precursor metabolites and energy; carbohydrate metabolic process; catabolic process; biosynthetic process; cellular amino acid and derivative metabolic process; cellular process;

GO Slim Component: cytosol; cell; mitochondrion; plastid; nucleus; plasma membrane; extracellular region;

Species: Rhizophora mangle

Sequence:
TGATGTGGAAACATCGAACGGTAAAAAGGTTAGAGCTGCAGTTCCAAGCG
GTGCATCCACTGGCGTTTACGAGGCTCTTGAATTGAGAGATGGAGGTTCC
GATTACCTTGGT

Back