Query: Rmv3_20899
Size: 159
GI: 302755124
Accession: XP_002960986
Short ID: atp synthase beta
Eval: 1.58E-21
Mean Similarity: 100
Alignment Length: 156
GO Function: hydrogen-exporting ATPase activity, phosphorylative mechanism; hydrogen ion transporting ATP synthase activity, rotational mechanism; ATP binding; proton-transporting ATPase activity, rotational mechanism;
GO Process: plasma membrane ATP synthesis coupled proton transport; auxin biosynthetic process;
GO Component: mitochondrial proton-transporting ATP synthase complex, catalytic core F(1);
GO Slim Function: hydrolase activity; transporter activity; nucleotide binding;
GO Slim Process: transport; generation of precursor metabolites and energy; nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; biosynthetic process; cellular process;
GO Slim Component: membrane; mitochondrion;
Species: Rhizophora mangle
Sequence:
CAAAGGTTGTTGCAGGAGCTGGATCTGTCAAATCATCAGCAGGCACATAA
ATGGCTTGAACAGAAGTAATAGAACCTTTCTTGGTCGTGGTAATACGCTC
TTGAAGACCTCCAAGATCAGTAGCCAAAGTTGGTTGGTAACCGACAGCAG
ATGGAATAC