Query: Rmv3_19487
Size: 109
GI: 145323645
Accession: NP_001031974
Short ID: acetyl- synthetase
Eval: 1.78E-12
Mean Similarity: 100
Alignment Length: 105
GO Function: AMP binding; acetate-CoA ligase activity;
GO Process: acetate metabolic process; gluconeogenesis; glycolysis; reductive tricarboxylic acid cycle;
GO Component: chloroplast stroma; cytosol;
GO Slim Function: nucleotide binding; catalytic activity;
GO Slim Process: metabolic process; cellular process; biosynthetic process; carbohydrate metabolic process; generation of precursor metabolites and energy; catabolic process;
GO Slim Component: plastid; cytosol;
Species: Rhizophora mangle
Sequence:
TTTTTGAAGGGGCTCCAAATTATCCTGATCCTGGTCGCTGTTGGGAAATT
GTTGACAAATTCAAGGTGACAATATTCTACACTGCTCCCACATTGGTGCG
GTCCCTCAT