Query: Rmv3_16304
Size: 130
GI: 3169287
Accession: AAC17840
Short ID: vacuolar h+-atpase catalytic subunit
Eval: 4.89E-15
Mean Similarity: 100
Alignment Length: 126
GO Function: hydrogen ion transporting ATP synthase activity, rotational mechanism; ATP binding; proton-transporting ATPase activity, rotational mechanism; ATPase activity, uncoupled;
GO Process: ATP synthesis coupled proton transport; purine base metabolic process;
GO Component: proton-transporting V-type ATPase, V1 domain; proton-transporting ATP synthase complex;
GO Slim Function: transporter activity; nucleotide binding; hydrolase activity;
GO Slim Process: transport; biosynthetic process; generation of precursor metabolites and energy; nucleobase, nucleoside, nucleotide and nucleic acid metabolic process;
GO Slim Component: membrane; intracellular;
Species: Rhizophora mangle
Sequence:
CTAGTCTCATCCTCCAATGCACGGAAACCAGCTGTGACGTCCTCGTTAAG
CTTTTTGAATTTTGCAACCAGAGCTTCTTCCCCTTCTGCTGGGTCTTCGA
ATTTTTGTGACACTAATCGATAAAAGAGAT